n a mouse Search Results


technology n a mouse  (Jackson Laboratory)
86
Jackson Laboratory technology n a mouse
Technology N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+a+mouse/a+mouse+n+technology/pm40233748-231-56-61
Average 86 stars, based on 1 article reviews
technology n a mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
ivo spiegel n a mouse  (Jackson Laboratory)
86
Jackson Laboratory ivo spiegel n a mouse
Ivo Spiegel N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+a+mouse/a+ivo+mouse+n+spiegel/pmc06226614__mmc2-241-21-26
Average 86 stars, based on 1 article reviews
ivo spiegel n a mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
dr d schlessigner nia nih n a mouse  (Jackson Laboratory)
86
Jackson Laboratory dr d schlessigner nia nih n a mouse
KEY RESOURCES TABLE
Dr D Schlessigner Nia Nih N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+a+mouse/a+dr+j+leonard+mouse+n+nhlbi+nih+w/pmc06532063-849-82-90
Average 86 stars, based on 1 article reviews
dr d schlessigner nia nih n a mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
e crawford81 n a mouse  (Jackson Laboratory)
86
Jackson Laboratory e crawford81 n a mouse
KEY RESOURCES TABLE
E Crawford81 N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+a+mouse/a+crawford81+e+mouse+n/pm38280375-462-206-211
Average 86 stars, based on 1 article reviews
e crawford81 n a mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
adrb2 flox g karsenty n a mouse  (Jackson Laboratory)
86
Jackson Laboratory adrb2 flox g karsenty n a mouse
(A) IF staining of MM from the ileum of LysMRiboTag mice using anti-MHC II (green) and anti-hemagglutinin (HA, red) antibodies. White arrows indicate MHC II+ HA- macrophages. Scale bars = 50 μm. Images representative of n=2 mice per group. (B) Volcano plot of differential expression analysis (DEseq2) of TRAPseq from LysMAdrb2fl/+:RiboTag mice comparing input (ileum tissue) to immunoprecipitated (i.p.) transcripts (red dots) All i.p. samples indicated by red dots are log2FoldChange > 0.5 and padj > 0.05. Relevant macrophage genes highlighted in black text and Nlrp6 (neuronal specific) highlighted in blue text. (C) Transcripts per million (TPM) as calculated by Kallisto alignment of <t>Adrb2</t> transcript comparing input (ileum tissue) or immunoprecipitated transcripts from LysMAdrb2fl/+:RiboTag and LysMΔAdrb2:RiboTag mice. (D-H) LysMΔAdrb2 and wild-type (WT) littermate control mice were orally infected with spiB. (D) Quantification of fecal colony forming units (CFU) on the indicated days post-infection (E) Quantification of fecal lipocalin-2 (Lcn-2) on the indicated days post-infection. (F) Total gastrointestinal transit time; experiments were ended at 450 min (dashed line); (G, H) Neuronal quantification in the ileum myenteric plexus on day 7 post-spiB infection of (G) LysMΔAdrb2 mice and WT littermates; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 mice and WT littermates (Figure S5B); (H) LysMΔAdrb2 and WT littermates receiving salbutamol via subcutaneous osmotic pumps and infected with spiB post-implantation; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 and WT littermate mice (Figure S5B). Unless indicated otherwise, data are representative of 3–6 mice per condition, were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S5 and Supplemental Information.
Adrb2 Flox G Karsenty N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+a+mouse/a+adrb2+flox+g+karsenty+mouse+n/pmc07271821-861-65-73
Average 86 stars, based on 1 article reviews
adrb2 flox g karsenty n a mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
n a mouse  (Jackson Laboratory)
86
Jackson Laboratory n a mouse
(A) IF staining of MM from the ileum of LysMRiboTag mice using anti-MHC II (green) and anti-hemagglutinin (HA, red) antibodies. White arrows indicate MHC II+ HA- macrophages. Scale bars = 50 μm. Images representative of n=2 mice per group. (B) Volcano plot of differential expression analysis (DEseq2) of TRAPseq from LysMAdrb2fl/+:RiboTag mice comparing input (ileum tissue) to immunoprecipitated (i.p.) transcripts (red dots) All i.p. samples indicated by red dots are log2FoldChange > 0.5 and padj > 0.05. Relevant macrophage genes highlighted in black text and Nlrp6 (neuronal specific) highlighted in blue text. (C) Transcripts per million (TPM) as calculated by Kallisto alignment of <t>Adrb2</t> transcript comparing input (ileum tissue) or immunoprecipitated transcripts from LysMAdrb2fl/+:RiboTag and LysMΔAdrb2:RiboTag mice. (D-H) LysMΔAdrb2 and wild-type (WT) littermate control mice were orally infected with spiB. (D) Quantification of fecal colony forming units (CFU) on the indicated days post-infection (E) Quantification of fecal lipocalin-2 (Lcn-2) on the indicated days post-infection. (F) Total gastrointestinal transit time; experiments were ended at 450 min (dashed line); (G, H) Neuronal quantification in the ileum myenteric plexus on day 7 post-spiB infection of (G) LysMΔAdrb2 mice and WT littermates; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 mice and WT littermates (Figure S5B); (H) LysMΔAdrb2 and WT littermates receiving salbutamol via subcutaneous osmotic pumps and infected with spiB post-implantation; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 and WT littermate mice (Figure S5B). Unless indicated otherwise, data are representative of 3–6 mice per condition, were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S5 and Supplemental Information.
N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+a+mouse/a+mouse+n/pm41747734-293-219-223
Average 86 stars, based on 1 article reviews
n a mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
paper n a mouse  (Jackson Laboratory)
86
Jackson Laboratory paper n a mouse
(A) IF staining of MM from the ileum of LysMRiboTag mice using anti-MHC II (green) and anti-hemagglutinin (HA, red) antibodies. White arrows indicate MHC II+ HA- macrophages. Scale bars = 50 μm. Images representative of n=2 mice per group. (B) Volcano plot of differential expression analysis (DEseq2) of TRAPseq from LysMAdrb2fl/+:RiboTag mice comparing input (ileum tissue) to immunoprecipitated (i.p.) transcripts (red dots) All i.p. samples indicated by red dots are log2FoldChange > 0.5 and padj > 0.05. Relevant macrophage genes highlighted in black text and Nlrp6 (neuronal specific) highlighted in blue text. (C) Transcripts per million (TPM) as calculated by Kallisto alignment of <t>Adrb2</t> transcript comparing input (ileum tissue) or immunoprecipitated transcripts from LysMAdrb2fl/+:RiboTag and LysMΔAdrb2:RiboTag mice. (D-H) LysMΔAdrb2 and wild-type (WT) littermate control mice were orally infected with spiB. (D) Quantification of fecal colony forming units (CFU) on the indicated days post-infection (E) Quantification of fecal lipocalin-2 (Lcn-2) on the indicated days post-infection. (F) Total gastrointestinal transit time; experiments were ended at 450 min (dashed line); (G, H) Neuronal quantification in the ileum myenteric plexus on day 7 post-spiB infection of (G) LysMΔAdrb2 mice and WT littermates; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 mice and WT littermates (Figure S5B); (H) LysMΔAdrb2 and WT littermates receiving salbutamol via subcutaneous osmotic pumps and infected with spiB post-implantation; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 and WT littermate mice (Figure S5B). Unless indicated otherwise, data are representative of 3–6 mice per condition, were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S5 and Supplemental Information.
Paper N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+a+mouse/a+mouse+n+paper/pm41308637-322-67-71
Average 86 stars, based on 1 article reviews
paper n a mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
china n a mouse  (Huafukang Technology)
86
Huafukang Technology china n a mouse
(A) IF staining of MM from the ileum of LysMRiboTag mice using anti-MHC II (green) and anti-hemagglutinin (HA, red) antibodies. White arrows indicate MHC II+ HA- macrophages. Scale bars = 50 μm. Images representative of n=2 mice per group. (B) Volcano plot of differential expression analysis (DEseq2) of TRAPseq from LysMAdrb2fl/+:RiboTag mice comparing input (ileum tissue) to immunoprecipitated (i.p.) transcripts (red dots) All i.p. samples indicated by red dots are log2FoldChange > 0.5 and padj > 0.05. Relevant macrophage genes highlighted in black text and Nlrp6 (neuronal specific) highlighted in blue text. (C) Transcripts per million (TPM) as calculated by Kallisto alignment of <t>Adrb2</t> transcript comparing input (ileum tissue) or immunoprecipitated transcripts from LysMAdrb2fl/+:RiboTag and LysMΔAdrb2:RiboTag mice. (D-H) LysMΔAdrb2 and wild-type (WT) littermate control mice were orally infected with spiB. (D) Quantification of fecal colony forming units (CFU) on the indicated days post-infection (E) Quantification of fecal lipocalin-2 (Lcn-2) on the indicated days post-infection. (F) Total gastrointestinal transit time; experiments were ended at 450 min (dashed line); (G, H) Neuronal quantification in the ileum myenteric plexus on day 7 post-spiB infection of (G) LysMΔAdrb2 mice and WT littermates; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 mice and WT littermates (Figure S5B); (H) LysMΔAdrb2 and WT littermates receiving salbutamol via subcutaneous osmotic pumps and infected with spiB post-implantation; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 and WT littermate mice (Figure S5B). Unless indicated otherwise, data are representative of 3–6 mice per condition, were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S5 and Supplemental Information.
China N A Mouse, supplied by Huafukang Technology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+a+mouse/a+china+mouse+n/pm39427314-228-133-138
Average 86 stars, based on 1 article reviews
china n a mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
utrecht n a mouse  (Jackson Laboratory)
86
Jackson Laboratory utrecht n a mouse
(A) IF staining of MM from the ileum of LysMRiboTag mice using anti-MHC II (green) and anti-hemagglutinin (HA, red) antibodies. White arrows indicate MHC II+ HA- macrophages. Scale bars = 50 μm. Images representative of n=2 mice per group. (B) Volcano plot of differential expression analysis (DEseq2) of TRAPseq from LysMAdrb2fl/+:RiboTag mice comparing input (ileum tissue) to immunoprecipitated (i.p.) transcripts (red dots) All i.p. samples indicated by red dots are log2FoldChange > 0.5 and padj > 0.05. Relevant macrophage genes highlighted in black text and Nlrp6 (neuronal specific) highlighted in blue text. (C) Transcripts per million (TPM) as calculated by Kallisto alignment of <t>Adrb2</t> transcript comparing input (ileum tissue) or immunoprecipitated transcripts from LysMAdrb2fl/+:RiboTag and LysMΔAdrb2:RiboTag mice. (D-H) LysMΔAdrb2 and wild-type (WT) littermate control mice were orally infected with spiB. (D) Quantification of fecal colony forming units (CFU) on the indicated days post-infection (E) Quantification of fecal lipocalin-2 (Lcn-2) on the indicated days post-infection. (F) Total gastrointestinal transit time; experiments were ended at 450 min (dashed line); (G, H) Neuronal quantification in the ileum myenteric plexus on day 7 post-spiB infection of (G) LysMΔAdrb2 mice and WT littermates; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 mice and WT littermates (Figure S5B); (H) LysMΔAdrb2 and WT littermates receiving salbutamol via subcutaneous osmotic pumps and infected with spiB post-implantation; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 and WT littermate mice (Figure S5B). Unless indicated otherwise, data are representative of 3–6 mice per condition, were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S5 and Supplemental Information.
Utrecht N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+a+mouse/a+mouse+n+utrecht/pm30917315-234-135-139
Average 86 stars, based on 1 article reviews
utrecht n a mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
mouse igg2a isotype control  (Bio X Cell)
93
Bio X Cell mouse igg2a isotype control
(A) IF staining of MM from the ileum of LysMRiboTag mice using anti-MHC II (green) and anti-hemagglutinin (HA, red) antibodies. White arrows indicate MHC II+ HA- macrophages. Scale bars = 50 μm. Images representative of n=2 mice per group. (B) Volcano plot of differential expression analysis (DEseq2) of TRAPseq from LysMAdrb2fl/+:RiboTag mice comparing input (ileum tissue) to immunoprecipitated (i.p.) transcripts (red dots) All i.p. samples indicated by red dots are log2FoldChange > 0.5 and padj > 0.05. Relevant macrophage genes highlighted in black text and Nlrp6 (neuronal specific) highlighted in blue text. (C) Transcripts per million (TPM) as calculated by Kallisto alignment of <t>Adrb2</t> transcript comparing input (ileum tissue) or immunoprecipitated transcripts from LysMAdrb2fl/+:RiboTag and LysMΔAdrb2:RiboTag mice. (D-H) LysMΔAdrb2 and wild-type (WT) littermate control mice were orally infected with spiB. (D) Quantification of fecal colony forming units (CFU) on the indicated days post-infection (E) Quantification of fecal lipocalin-2 (Lcn-2) on the indicated days post-infection. (F) Total gastrointestinal transit time; experiments were ended at 450 min (dashed line); (G, H) Neuronal quantification in the ileum myenteric plexus on day 7 post-spiB infection of (G) LysMΔAdrb2 mice and WT littermates; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 mice and WT littermates (Figure S5B); (H) LysMΔAdrb2 and WT littermates receiving salbutamol via subcutaneous osmotic pumps and infected with spiB post-implantation; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 and WT littermate mice (Figure S5B). Unless indicated otherwise, data are representative of 3–6 mice per condition, were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S5 and Supplemental Information.
Mouse Igg2a Isotype Control, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+a+mouse/RecombiMAb+mouse+IgG2b+(LALA-PG)+isotype+control%2C+anti-hen+egg+lysozyme/pm32103175-386-2-6
Average 93 stars, based on 1 article reviews
mouse igg2a isotype control - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
anti mouse igg2a isotype control  (Bio X Cell)
93
Bio X Cell anti mouse igg2a isotype control
Anti-IL-9 antibody treatment decreased mast cell infiltration of the CNS. Purified cells (mainly composed of mast cells) were harvested from the CNS on days 0, and 5, 15, and 20 after EAE immunization. CD45 + CD117 + mast cells were detected by flow cytometry. CNS mast cells maintained a high level throughout the disease course in EAE group. However, mast cells were significantly reduced from day 5, and remained low in anti-IL-9 Abs group, compared with <t>IgG</t> group. Data are shown as mean ± SE. * P < 0.01, anti-IL-9 Abs group versus IgG group. CNS: Central nervous system; EAE: Experimental autoimmune encephalomyelitis; SE: Standard error; IL: Interleukin.
Anti Mouse Igg2a Isotype Control, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+a+mouse/RecombiMAb+mouse+IgG2a+(LALA-PG)+isotype+control%2C+anti-hen+egg+lysozyme/pmc05407044-61-20-25
Average 93 stars, based on 1 article reviews
anti mouse igg2a isotype control - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
mouse igg1 isotype control  (Bio X Cell)
94
Bio X Cell mouse igg1 isotype control
Anti-IL-9 antibody treatment decreased mast cell infiltration of the CNS. Purified cells (mainly composed of mast cells) were harvested from the CNS on days 0, and 5, 15, and 20 after EAE immunization. CD45 + CD117 + mast cells were detected by flow cytometry. CNS mast cells maintained a high level throughout the disease course in EAE group. However, mast cells were significantly reduced from day 5, and remained low in anti-IL-9 Abs group, compared with <t>IgG</t> group. Data are shown as mean ± SE. * P < 0.01, anti-IL-9 Abs group versus IgG group. CNS: Central nervous system; EAE: Experimental autoimmune encephalomyelitis; SE: Standard error; IL: Interleukin.
Mouse Igg1 Isotype Control, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+a+mouse/RecombiMAb+mouse+IgG1+(D265A)+isotype+control%2C+anti-hen+egg+lysozyme/pmc11372167-378-6-10
Average 94 stars, based on 1 article reviews
mouse igg1 isotype control - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Cell

Article Title: Homeostatic Control of Sebaceous Glands by Innate Lymphoid Cells Regulates Commensal Bacteria Equilibrium

doi: 10.1016/j.cell.2018.12.031

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Park (NCI/NIH) N/A Mouse: Tslp −/− Dr. S. Nakae (University of Tokyo) CDB0777K (RIKEN) Mouse: Il7 −/− Tslp −/− Dr. K. Moro (RIKEN) N/A Mouse: Tslpr −/− Dr. W. J. Leonard (NHLBI/NIH) N/A Mouse: B6.129S6- Ccr6 tm1(EGFP)Irw /J ( Ccr6 GFP/GFP ) Jackson Laboratory Stock No: 013061 Mouse: Tnf −/− Dr. D. Schlessigner (NIA/NIH) N/A Mouse: Lta −/− Dr. D. Schlessigner (NIA/NIH) N/A Mouse: Ltb −/− Dr. D. Schlessigner (NIA/NIH) N/A Mouse: Tnf −/− Lta − / − Ltb − / − Dr. D. Schlessigner (NIA/NIH) N/A Mouse: B6.FVB-Tg(Rorc-cre)1Litt/J (Rorc-Cre) Jackson Laboratory Stock No: 022791 Mouse: B6.129X1- Gt(ROSA)26Sor tm1(EYFP)Cos /J (ROSA-EYFP) Jackson Laboratory Stock No: 006148 Mouse: B6;SJL-Tg(Krt1–15-cre/PGR)22Cot/J Jackson Laboratory Stock No: 005249 Mouse: Adam10 tm1.1Khr (Adam10 flox ) Dr. K. Horiuchi (National Defense Medical College) N/A Software and Algorithms FlowJo FlowJo, LLC https://www.flowjo.com/solutions/flowjo Partek Flow Partek http://www.partek.com/partekflow Partek Genomics Suite Partek http://www.partek.com/pgs nSolver Analysis Software 4.0 NanoString Technologies https://www.nanostring.com/products/analysis-software/nsolver GraphPad Prism GraphPad Software https://www.graphpad.com/ Imaris Bitplane http://www.bitplane.com/ Seurat Satija Lab https://satijalab.org/seurat/ Open in a separate window KEY RESOURCES TABLE

Techniques: Purification, Virus, Isolation, Recombinant, Staining, Transfection, Electron Microscopy, dsDNA Assay, Software

(A) IF staining of MM from the ileum of LysMRiboTag mice using anti-MHC II (green) and anti-hemagglutinin (HA, red) antibodies. White arrows indicate MHC II+ HA- macrophages. Scale bars = 50 μm. Images representative of n=2 mice per group. (B) Volcano plot of differential expression analysis (DEseq2) of TRAPseq from LysMAdrb2fl/+:RiboTag mice comparing input (ileum tissue) to immunoprecipitated (i.p.) transcripts (red dots) All i.p. samples indicated by red dots are log2FoldChange > 0.5 and padj > 0.05. Relevant macrophage genes highlighted in black text and Nlrp6 (neuronal specific) highlighted in blue text. (C) Transcripts per million (TPM) as calculated by Kallisto alignment of Adrb2 transcript comparing input (ileum tissue) or immunoprecipitated transcripts from LysMAdrb2fl/+:RiboTag and LysMΔAdrb2:RiboTag mice. (D-H) LysMΔAdrb2 and wild-type (WT) littermate control mice were orally infected with spiB. (D) Quantification of fecal colony forming units (CFU) on the indicated days post-infection (E) Quantification of fecal lipocalin-2 (Lcn-2) on the indicated days post-infection. (F) Total gastrointestinal transit time; experiments were ended at 450 min (dashed line); (G, H) Neuronal quantification in the ileum myenteric plexus on day 7 post-spiB infection of (G) LysMΔAdrb2 mice and WT littermates; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 mice and WT littermates (Figure S5B); (H) LysMΔAdrb2 and WT littermates receiving salbutamol via subcutaneous osmotic pumps and infected with spiB post-implantation; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 and WT littermate mice (Figure S5B). Unless indicated otherwise, data are representative of 3–6 mice per condition, were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S5 and Supplemental Information.

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: (A) IF staining of MM from the ileum of LysMRiboTag mice using anti-MHC II (green) and anti-hemagglutinin (HA, red) antibodies. White arrows indicate MHC II+ HA- macrophages. Scale bars = 50 μm. Images representative of n=2 mice per group. (B) Volcano plot of differential expression analysis (DEseq2) of TRAPseq from LysMAdrb2fl/+:RiboTag mice comparing input (ileum tissue) to immunoprecipitated (i.p.) transcripts (red dots) All i.p. samples indicated by red dots are log2FoldChange > 0.5 and padj > 0.05. Relevant macrophage genes highlighted in black text and Nlrp6 (neuronal specific) highlighted in blue text. (C) Transcripts per million (TPM) as calculated by Kallisto alignment of Adrb2 transcript comparing input (ileum tissue) or immunoprecipitated transcripts from LysMAdrb2fl/+:RiboTag and LysMΔAdrb2:RiboTag mice. (D-H) LysMΔAdrb2 and wild-type (WT) littermate control mice were orally infected with spiB. (D) Quantification of fecal colony forming units (CFU) on the indicated days post-infection (E) Quantification of fecal lipocalin-2 (Lcn-2) on the indicated days post-infection. (F) Total gastrointestinal transit time; experiments were ended at 450 min (dashed line); (G, H) Neuronal quantification in the ileum myenteric plexus on day 7 post-spiB infection of (G) LysMΔAdrb2 mice and WT littermates; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 mice and WT littermates (Figure S5B); (H) LysMΔAdrb2 and WT littermates receiving salbutamol via subcutaneous osmotic pumps and infected with spiB post-implantation; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 and WT littermate mice (Figure S5B). Unless indicated otherwise, data are representative of 3–6 mice per condition, were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S5 and Supplemental Information.

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Staining, Quantitative Proteomics, Immunoprecipitation, Control, Infection

Data and Software Availability

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: Data and Software Availability

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Software, Staining, Recombinant, Saline, DNA Extraction, RNAscope, Binding Assay, Enzyme-linked Immunosorbent Assay, Isolation, Generated, RNA Sequencing, Gene Expression

Anti-IL-9 antibody treatment decreased mast cell infiltration of the CNS. Purified cells (mainly composed of mast cells) were harvested from the CNS on days 0, and 5, 15, and 20 after EAE immunization. CD45 + CD117 + mast cells were detected by flow cytometry. CNS mast cells maintained a high level throughout the disease course in EAE group. However, mast cells were significantly reduced from day 5, and remained low in anti-IL-9 Abs group, compared with IgG group. Data are shown as mean ± SE. * P < 0.01, anti-IL-9 Abs group versus IgG group. CNS: Central nervous system; EAE: Experimental autoimmune encephalomyelitis; SE: Standard error; IL: Interleukin.

Journal: Chinese Medical Journal

Article Title: Neutralization of Interleukin-9 Decreasing Mast Cells Infiltration in Experimental Autoimmune Encephalomyelitis

doi: 10.4103/0366-6999.204110

Figure Lengend Snippet: Anti-IL-9 antibody treatment decreased mast cell infiltration of the CNS. Purified cells (mainly composed of mast cells) were harvested from the CNS on days 0, and 5, 15, and 20 after EAE immunization. CD45 + CD117 + mast cells were detected by flow cytometry. CNS mast cells maintained a high level throughout the disease course in EAE group. However, mast cells were significantly reduced from day 5, and remained low in anti-IL-9 Abs group, compared with IgG group. Data are shown as mean ± SE. * P < 0.01, anti-IL-9 Abs group versus IgG group. CNS: Central nervous system; EAE: Experimental autoimmune encephalomyelitis; SE: Standard error; IL: Interleukin.

Article Snippet: The following antibodies were used in this study: FITC-anti-mouse CD45 (eBioscience, USA), PE-Cyanine5-anti-mouse CD117 (eBioscience), anti-mouse IL-9 (BE0181; BioXCell, USA), anti-mouse IgG2a isotype control (BE0085; BioXCell), anti-mouse IL-9 receptor (IL-9R) (SC699; Santa Cruz, USA), anti-mouse IL-2Rγ (SC668; Santa Cruz), anti-mouse IgG isotype control (GTX35009; Santa Cruz), and donkey pAb to Rb IgG Alexa Flour 555 (Ab150074; Abcam, USA).

Techniques: Purification, Flow Cytometry

IL-9 blockade reduced production of chemokine recruiting mast cells in the CNS. Five days after immunization, mRNA expressions of Pecam1, SCF, Vcam-1, CCL2, and CCL5 in CNS tissue of EAE mice were detected by RT-PCR. After IL-9 neutralization, mRNA expressions of CCL5 and Vcam-1 were significantly decreased in anti-IL-9 Abs group, compared with IgG group. * P < 0.01. Pecam1: Platelet and endothelial cell adhesion molecule 1; SCF: Supercoiling factor; Vcam-1: Vascular cell adhesion molecule 1; CCL2: C-C motif chemokine ligand 2; CCL5: C-C motif chemokine ligand 5; CNS: Central nervous system; EAE: Experimental autoimmune encephalomyelitis; IL: Interleukin; RT-PCR: Reverse transcription-polymerase chain reaction; mRNA: Messenger RNA.

Journal: Chinese Medical Journal

Article Title: Neutralization of Interleukin-9 Decreasing Mast Cells Infiltration in Experimental Autoimmune Encephalomyelitis

doi: 10.4103/0366-6999.204110

Figure Lengend Snippet: IL-9 blockade reduced production of chemokine recruiting mast cells in the CNS. Five days after immunization, mRNA expressions of Pecam1, SCF, Vcam-1, CCL2, and CCL5 in CNS tissue of EAE mice were detected by RT-PCR. After IL-9 neutralization, mRNA expressions of CCL5 and Vcam-1 were significantly decreased in anti-IL-9 Abs group, compared with IgG group. * P < 0.01. Pecam1: Platelet and endothelial cell adhesion molecule 1; SCF: Supercoiling factor; Vcam-1: Vascular cell adhesion molecule 1; CCL2: C-C motif chemokine ligand 2; CCL5: C-C motif chemokine ligand 5; CNS: Central nervous system; EAE: Experimental autoimmune encephalomyelitis; IL: Interleukin; RT-PCR: Reverse transcription-polymerase chain reaction; mRNA: Messenger RNA.

Article Snippet: The following antibodies were used in this study: FITC-anti-mouse CD45 (eBioscience, USA), PE-Cyanine5-anti-mouse CD117 (eBioscience), anti-mouse IL-9 (BE0181; BioXCell, USA), anti-mouse IgG2a isotype control (BE0085; BioXCell), anti-mouse IL-9 receptor (IL-9R) (SC699; Santa Cruz, USA), anti-mouse IL-2Rγ (SC668; Santa Cruz), anti-mouse IgG isotype control (GTX35009; Santa Cruz), and donkey pAb to Rb IgG Alexa Flour 555 (Ab150074; Abcam, USA).

Techniques: Reverse Transcription Polymerase Chain Reaction, Neutralization

In vitro , the effect of anti-IL-9 antibody on splenic mast cells. Splenocytes were harvested from experimental autoimmune encephalomyelitis mice 5 days after MOG immunization. After co-culture with anti-IL-9 antibody or anti-mouse IgG for 7 h, mast cell number was counted by flow cytometry. Splenic mast cells cultured with anti-IL-9 antibody showed significantly lower levels in a dose-dependent manner. This trend was particularly evident with anti-IL-9 antibody concentrations up to 20 μg/ml. * P < 0.05; † P < 0.01. IL: Interleukin; MOG: Myelin oligodendrocyte glycoprotein.

Journal: Chinese Medical Journal

Article Title: Neutralization of Interleukin-9 Decreasing Mast Cells Infiltration in Experimental Autoimmune Encephalomyelitis

doi: 10.4103/0366-6999.204110

Figure Lengend Snippet: In vitro , the effect of anti-IL-9 antibody on splenic mast cells. Splenocytes were harvested from experimental autoimmune encephalomyelitis mice 5 days after MOG immunization. After co-culture with anti-IL-9 antibody or anti-mouse IgG for 7 h, mast cell number was counted by flow cytometry. Splenic mast cells cultured with anti-IL-9 antibody showed significantly lower levels in a dose-dependent manner. This trend was particularly evident with anti-IL-9 antibody concentrations up to 20 μg/ml. * P < 0.05; † P < 0.01. IL: Interleukin; MOG: Myelin oligodendrocyte glycoprotein.

Article Snippet: The following antibodies were used in this study: FITC-anti-mouse CD45 (eBioscience, USA), PE-Cyanine5-anti-mouse CD117 (eBioscience), anti-mouse IL-9 (BE0181; BioXCell, USA), anti-mouse IgG2a isotype control (BE0085; BioXCell), anti-mouse IL-9 receptor (IL-9R) (SC699; Santa Cruz, USA), anti-mouse IL-2Rγ (SC668; Santa Cruz), anti-mouse IgG isotype control (GTX35009; Santa Cruz), and donkey pAb to Rb IgG Alexa Flour 555 (Ab150074; Abcam, USA).

Techniques: In Vitro, Co-Culture Assay, Flow Cytometry, Cell Culture